View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9306_low_26 (Length: 311)
Name: NF9306_low_26
Description: NF9306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9306_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 9216403 - 9216099
Alignment:
| Q |
18 |
atatacatcaacacgttgaagtacttgaacggaacactaggacaagctatacttttgtcctcaaattcaaatttgcatgtttcagcatagtca------- |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9216403 |
atatacatcaacacgttgaagtacttgaacggaacactaggacaaggtatacttttgtcctctaattcaaatttgcatgtttcagcatagtcacatgttt |
9216304 |
T |
|
| Q |
111 |
-----------aatgccgattggggaagttttgtgtttcaacctaacagcttgcaaagtgttttgttacaacacttctaccattcaaatggcaagtaatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9216303 |
cagcatagtaaaatgccgattggggaagttttgtgtttcaacctaacagcttgcaaagggttttgttacaacacttctaccattcaaatggcaagtaatc |
9216204 |
T |
|
| Q |
200 |
ttatgagctatgagatcgcaaaacacagatattgattgccgttttataagagagcatgttaccggagacttcttgaaatcgatccatattctttcaaaac |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9216203 |
ttatgagctatgagatcgcaaaacacagatattgattgccgttttataagagagcatgttaccagagacttcttgaaatcgatccatattctttcaaaac |
9216104 |
T |
|
| Q |
300 |
accaa |
304 |
Q |
| |
|
||||| |
|
|
| T |
9216103 |
accaa |
9216099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University