View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9306_low_40 (Length: 248)
Name: NF9306_low_40
Description: NF9306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9306_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 111 - 244
Target Start/End: Original strand, 36479131 - 36479264
Alignment:
| Q |
111 |
ctggattattgcagattcatgatatttgttggcatgttaagttcgagataaatggatcctcttttagtagtgttcttggttgttttcggaagttgctgga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479131 |
ctggattattgcagattcatgatatttgttggcatgttaagttcgagataaatggatcctcttttagtagtgttcttggttgttttcggaagttgctgga |
36479230 |
T |
|
| Q |
211 |
tcggtttctctcaaaatatgccacaggttctgct |
244 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||| |
|
|
| T |
36479231 |
tcggtttctctcaaaatatgctactggtgctgct |
36479264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 36479027 - 36479065
Alignment:
| Q |
7 |
atatctatactcagacatcacgattggtagtaaaattct |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479027 |
atatctatactcagacatcacgattggtagtaaaattct |
36479065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University