View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9306_low_51 (Length: 237)
Name: NF9306_low_51
Description: NF9306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9306_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 15226876 - 15227109
Alignment:
| Q |
1 |
actagctctattgaaagaataatggagccgccaattttttgagaggtcacttg-ttgaaagataaacttttcaaccacgtcgaacttaatttgagacttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15226876 |
actagctctattgaaagaataatggagccgccaattttttgagaggtcacttggttgaaagataaacttttcaaccacgtcgaacttaatttgagacttg |
15226975 |
T |
 |
| Q |
100 |
gcaatgagaaagaagcatagaaagaagaatgatgccgagctttataacattattacaaagcaatatgatggtggatccactagcaatatagattgcagta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15226976 |
gcaatgagaaagaagcatagaaagaagaatgatgccgaactttataacattattacaaagcaatacgatggtggatccactagcaatatagattgcagta |
15227075 |
T |
 |
| Q |
200 |
ggcatctatgcagttgatcgaggatccaaatcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15227076 |
ggcatctatgcagttgatcgaggatccaaatcca |
15227109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University