View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_high_11 (Length: 257)
Name: NF9308_high_11
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 104 - 242
Target Start/End: Complemental strand, 7421005 - 7420867
Alignment:
| Q |
104 |
attatcaaccgagatagaaaactttctccggaaaagtttgacaggtttataatattatgcggagactaatcaagttgcagatgctatgtcaaatatgaca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7421005 |
attatcaaccgagatagaaaactttctccggaaaagtttgtcgggtttataatattatgcggagactaatcaagttgcagatgctatgtcaaatatggca |
7420906 |
T |
 |
| Q |
204 |
gtatttcttttagagttgggagttttgccccaagttctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7420905 |
gtatttcttttagagttgggagttttgctccaagttctt |
7420867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University