View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9308_high_11 (Length: 257)

Name: NF9308_high_11
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9308_high_11
NF9308_high_11
[»] chr7 (1 HSPs)
chr7 (104-242)||(7420867-7421005)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 104 - 242
Target Start/End: Complemental strand, 7421005 - 7420867
Alignment:
104 attatcaaccgagatagaaaactttctccggaaaagtttgacaggtttataatattatgcggagactaatcaagttgcagatgctatgtcaaatatgaca 203  Q
    |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
7421005 attatcaaccgagatagaaaactttctccggaaaagtttgtcgggtttataatattatgcggagactaatcaagttgcagatgctatgtcaaatatggca 7420906  T
204 gtatttcttttagagttgggagttttgccccaagttctt 242  Q
    |||||||||||||||||||||||||||| ||||||||||    
7420905 gtatttcttttagagttgggagttttgctccaagttctt 7420867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University