View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_high_12 (Length: 252)
Name: NF9308_high_12
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 246
Target Start/End: Original strand, 30837653 - 30837879
Alignment:
| Q |
20 |
accttaacagaaatggttccagccaaagcatcaagatcttcaagcaactttccaatcccaacatcattccaaggatccccatattgttccctaagaacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30837653 |
accttaacagaaatggttccagccaaagcatcaagatcttcaagcaactttccaatcctaacatcattccaaggatccctatattgttccctaagaacaa |
30837752 |
T |
 |
| Q |
120 |
aatcagaagaaaaattataaagaatactggttctactctgtgaaggggttctagtaaccaattcactttgaggaggagcatctcttggtggatcaagaag |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30837753 |
aatcagaagaaaaattatacagaatactggttctactctgtgaaggggttctagtaaccaattcactttgaggaggagcatctcttggtggatcaagaag |
30837852 |
T |
 |
| Q |
220 |
tctctcaaagatttttccctttgcttc |
246 |
Q |
| |
|
||||||||||||||| ||| ||||||| |
|
|
| T |
30837853 |
tctctcaaagattttgccccttgcttc |
30837879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University