View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_high_8 (Length: 304)
Name: NF9308_high_8
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 287
Target Start/End: Complemental strand, 32379303 - 32379027
Alignment:
| Q |
11 |
cagagatcagagttttcatctcttcacgaagaatggctgaagaccttgatgtctatcgcaagaatagaggatgctgaatcttttgatgatgatgttttag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32379303 |
cagagatcagagttttcatctcttcacgaagaatggctgaagaccttgatgtctatcgcaagaatagaggatgttgaatcttttgatgatgatgttttag |
32379204 |
T |
 |
| Q |
111 |
atacattagtctgtttgcggtatgaactaaagtcttcgtttaaatcaggtaactagagatgtagagtgcagcaggtagggctactaatcttacttctaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32379203 |
atacattagtctgtttgcggtatgaactaaagtcttcgtttaaatcaggtaactagagatgtagagtgcagcaggtagggctactaatcttacttctaca |
32379104 |
T |
 |
| Q |
211 |
aaactgcttgtaaatttttacttatttccttagtgattaaagaacacctgttttcattttggaaaaccgtggcttgt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32379103 |
aaactgcttgtaaatttttacttatttccttagtgattaaagaacacctgttttcattttggaaaaacgtggcttgt |
32379027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University