View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_37 (Length: 325)
Name: NF9308_low_37
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 8 - 269
Target Start/End: Original strand, 34688226 - 34688487
Alignment:
| Q |
8 |
gagcagagagtgcagcaagaaaaagttgagaggaacctgtccctacaacaatgtgacgtccttctgtgactgcattcccgaccactctgtgcaacctcac |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688226 |
gagcatagagtgcagcaagaaaaagttgagaggaacctgtccctacaacaatgtgacgtccttctgtgactgcattcccgaccactctgtgcaacctcac |
34688325 |
T |
|
| Q |
108 |
tacctcctttgcaaactctgcctcaagaaaccaacatatgttcgacacatccgaaaaatagctcatggattgccatcctggtattatgatcgtgctcttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688326 |
tacctcctttgcaaactctgcctcaagaaaccaacatatgttcgacacatccgaaaaatagctcatggattgccatcctggtattatgatcgtgctcttg |
34688425 |
T |
|
| Q |
208 |
tcacctgtttgtctccaaaatctttcatatactgtcggatccccactgcatatacatttaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34688426 |
tcacctgtttgtctccaaaatctttcatatactgtcggatccccactgcatatacatataat |
34688487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 263 - 308
Target Start/End: Original strand, 34688527 - 34688572
Alignment:
| Q |
263 |
atttaattgattgaagtcaattgaccacaatttaaaaaatagatca |
308 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34688527 |
atttaattgattcaagtcaattgaccacaatttaaaaaatagatca |
34688572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 34 - 209
Target Start/End: Original strand, 43614430 - 43614605
Alignment:
| Q |
34 |
tgagaggaacctgtccctacaacaatgtgacgtccttctgtgactgcattcccgaccactctgtgcaacctcactacctcctttgcaaactctgcctcaa |
133 |
Q |
| |
|
||||| |||||||| || ||||||| ||| || |||| ||| |||||||| || ||||| | || ||||||||||| ||||||| ||| |||| ||||| |
|
|
| T |
43614430 |
tgagatgaacctgttccaacaacaacgtgtcgaccttgtgttactgcatttccaaccacattatgtaacctcactacttcctttgaaaattctggctcaa |
43614529 |
T |
|
| Q |
134 |
gaaaccaacatatgttcgacacatccgaaaaatagctcatggattgccatcctggtattatgatcgtgctcttgtc |
209 |
Q |
| |
|
|||||||||| ||| | | ||| |||||||| ||||| |||||||||||||||||||| || ||| ||||||| |
|
|
| T |
43614530 |
gaaaccaacaaatgcttgttggatcagaaaaataactcatagattgccatcctggtattattattgtggtcttgtc |
43614605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University