View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_49 (Length: 256)
Name: NF9308_low_49
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 52241428 - 52241653
Alignment:
| Q |
14 |
aattcttatcgtaattaaaa-tgatgtgaatgaacattataacaagcttttcctttttgtggttacagtttccaatgcattacatctttnnnnnnnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52241428 |
aattcttatcgtaattaaaaatgatgtgaatgaacattataacaagcttttcctttttgtggttacagtttccaatgcattacatctttaaaaaaaaa-- |
52241525 |
T |
|
| Q |
113 |
tatatattccaatgctgaatcttaatttgttcctattttttgaatttgtcttctggttaatgaccggttgatatggactcagttgaattttctcaacaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52241526 |
-atatattccaatgctgaatcttaatttggtgctaatttttgaatttgtcttctggttaatgaccggttgatatggactcagttgaattttctcaacaac |
52241624 |
T |
|
| Q |
213 |
gatagagagtaatctcatttcaaacatta |
241 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
52241625 |
gatagagactaatctcatttcaaacatta |
52241653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University