View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_55 (Length: 249)
Name: NF9308_low_55
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 41 - 224
Target Start/End: Original strand, 32873009 - 32873195
Alignment:
| Q |
41 |
gatcttaagcatggtttagcttatgtttttaacaaatatattctacatcatgtacgattatatccaatgataatcttgccattatcgaagttgatatata |
140 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32873009 |
gatcttaagcatggtttagtttatgtttttaacgaatatattctacatcatgtacgattatatccaatggtaatcttgccattatcgaagttgatatatt |
32873108 |
T |
 |
| Q |
141 |
tgagtaactgaatcatcattaaagtaaaatcatc---actactcacaagggagtgtttagaaagcatggtaaaaagaatagtagcta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32873109 |
tgagtaactgaatcatcattaaagtaaaatcatcactactactcactagggagtgtttagaaagcatggtaaaaagaacagtagcta |
32873195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University