View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_63 (Length: 244)
Name: NF9308_low_63
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 8661266 - 8661456
Alignment:
| Q |
20 |
gttatatggtggggaaaaagggtcaaagtgtctttgccaacgatattcaaaagttctacaacactacatagaattggccactcttaaataatattaccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8661266 |
gttatatggtggggaaaaagggtcaaagtgtctttgccaacgatattcaaaagttctacaacactacatagaattggccactcttaaataatattaccat |
8661365 |
T |
 |
| Q |
120 |
gatatgctttcgtatgtttctaagaagctattctgttcacttctggtcccactctaagttatataaagaggttgtttgctcctcacaggtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8661366 |
gatatgctttcgtatgtttctaagaagctattcagttcacttctggtcccactctaagtcatataaagaggttgtttgctcctcccaggtt |
8661456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University