View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_64 (Length: 243)
Name: NF9308_low_64
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 56 - 227
Target Start/End: Complemental strand, 29287703 - 29287532
Alignment:
| Q |
56 |
gcgcgtttgggagaaacaaacagaaacgcgcgcatctcaactgctgcaacagctgtggcatggcagaagtagtgtagcagatgcacctttgtgaagaaaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287703 |
gcgcgtttgggagaaacaaacagaaacacgcgcatctcaactgctgcaacagctgtggcatggcagaagtagtgtagcagatgcacctttgtgaagaaaa |
29287604 |
T |
|
| Q |
156 |
cctgatatgtcgcgcggaaaatgcaacatagactcctatttttcctttaataaaaaccgaggtaggtgttga |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287603 |
cctgatatgtcgtgcggaaaatgcaacatagactcctatttttcctttaataaaaaccgaggtaggtgttga |
29287532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 28 - 227
Target Start/End: Complemental strand, 35236436 - 35236241
Alignment:
| Q |
28 |
tgtggagaatttggaagagttggagcttgcgcgtttgggagaaacaaacagaaacgcgcgcatctcaactgctgcaacagctgtggcatggcagaagtag |
127 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| ||||||||||||||||||||||| |||||| |||| | || |||||| ||||||||| ||||| || |
|
|
| T |
35236436 |
tgtggagaatttggaagagtcggaacttgcgtgtttgggagaaacaaacagaaacacgcgca-ctca---gttgaaacagccgtggcatgggagaagcag |
35236341 |
T |
|
| Q |
128 |
tgtagcagatgcacctttgtgaagaaaacctgatatgtcgcgcggaaaatgcaacatagactcctatttttcctttaataaaaaccgaggtaggtgttga |
227 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
35236340 |
cgtggcagatgcacctttgtggagaaaacctgatatgtcgcgaggaaaatgcaacatagactcctatttttcttttaataaaaaccggggtaggttttga |
35236241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 29290878 - 29290835
Alignment:
| Q |
18 |
gtgtttacaatgtggagaatttggaagagttggagcttgcgcgt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29290878 |
gtgtttacaatgtggagaatttggaagagttggagcttgcgcgt |
29290835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University