View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_66 (Length: 242)
Name: NF9308_low_66
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 47 - 232
Target Start/End: Complemental strand, 14163846 - 14163661
Alignment:
| Q |
47 |
tattgtgtaaataaatctaaagtttgctagaaggctagttaaagtaattatgaataaatggagcatgcaaatttatgccttcataagtgtaaatttaaaa |
146 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14163846 |
tattgtgtaaataaatttaaagtttgctagaaggctagttaaagtaattatgaatcaatggagcatgcaaatttatgccttcataagtgtaaatttaaaa |
14163747 |
T |
 |
| Q |
147 |
acaaagataacaaaaaactaatcttaacatgtggttcttctgagtggtaagacacttgaacgccttaaacaagtggtctgatgtcc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14163746 |
acaaagataacaaaaaactaatcttaacatgtggttcttctgagtggtaagacacttgaacaccttaaacaagtggtctgaagtcc |
14163661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University