View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_74 (Length: 239)
Name: NF9308_low_74
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 34688649 - 34688872
Alignment:
| Q |
1 |
atctgattttacaaaaaattacaaacttttatgtgctaattcatgtcttctaatttgtacttacaaaattgagttaaacttatgtttcgatggacatgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34688649 |
atctgattttacaaaaaattacaaacttttatgtgctaattcatgtcttctaatttgtacttacaaaattgagtttaacttatgtttcgatggacatgcc |
34688748 |
T |
 |
| Q |
101 |
atgattttatagaaatttcgaagttgtggtgtgtttgaactttcaaattgccaatccagtgactcatcgtgattttgacaatcaccccaaactaatacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34688749 |
atgattttatagaaatttcgaagttgtggtgtgtttgaactttcggattgccaatctagtgactcatcgtgattttgacaatcaccccaaactaaaacat |
34688848 |
T |
 |
| Q |
201 |
gcacttattttgaagagtgtaact |
224 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
34688849 |
gcacttattttaaagagtgtaact |
34688872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University