View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_78 (Length: 233)
Name: NF9308_low_78
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 55103865 - 55103664
Alignment:
| Q |
18 |
aattggacaagcaacaaataaattaatgaaagagtaaaaacatgggaagttggtcttaaactggagctaccatttggtaacatagggaatgtgtcaggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55103865 |
aattggacaagcaacaaataaattaatgaaagagtaaaaacatgggaagttggtcttaaactggagctaccatttggtaacatagggaatgtgtcaggta |
55103766 |
T |
|
| Q |
118 |
aaggcatgtcacagttttcaccgttgaaatatattcttcttggaaatgtccatccgttttgcaatgtgaaggaattctcatctttttccaatagtatctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55103765 |
aaggcatgtcacagttttcaccgttgaaatatattcttcttggaaatgtccatccgttttgcaatgtgaaggaattctcatctttttccaatagtatctc |
55103666 |
T |
|
| Q |
218 |
tg |
219 |
Q |
| |
|
|| |
|
|
| T |
55103665 |
tg |
55103664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University