View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_82 (Length: 229)
Name: NF9308_low_82
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 16960927 - 16960705
Alignment:
| Q |
5 |
caatgaggatcttcactttgtgaatttatcttcaaatcttttgaaaggtgaactacctagttgtttgagaccaaagacaagagttgttttgtatgctaga |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16960927 |
caatgaggatcttcactttgtgaatttatcttcaaatcttttgaaaggtgaactacctagttgtttgagaccaaaaacgagagttgttttgtatgctagg |
16960828 |
T |
|
| Q |
105 |
aattgtttatcaaacgagaaacaagatcagcatagttacaatttctgcagcagtgaagctttagcggtgaatattacgcctcgtcaacaacagaagcata |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| |
|
|
| T |
16960827 |
aattgtttatcaaatgagaaacaagatcagcatagttacaatttctgcagcagtgaagctttagcggtgaatatctcgcctcatcgacaacagaagcata |
16960728 |
T |
|
| Q |
205 |
agggaacaactagtaaagcagta |
227 |
Q |
| |
|
||||||||| || ||||||||| |
|
|
| T |
16960727 |
agggaacaataagcaaagcagta |
16960705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University