View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_86 (Length: 226)
Name: NF9308_low_86
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 42481936 - 42482133
Alignment:
| Q |
11 |
agataattctccaccgccggagccatcaccggagagtctccgccatgtaagccgtatgatcaacagcaaccattacacctcaccttctcgaacaatctac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42481936 |
agataattctccaccgccggagccatcaccggagagtctccgccatgtaagccgtatgatcaacagcaaccattacacctcaccttctcgaacaatctac |
42482035 |
T |
|
| Q |
111 |
tccgataggttcattccgagtagatctgcttcgaaattcgctttgtttgatatcaatactccgacggaaggacgcgatgatagttccagcgcttatac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42482036 |
tccgataggttcattccgagtagatctgcttcgaaattcgctttgtttgatatcaatactccgacggaaggacgcgatgatagttccagcgcttatac |
42482133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 118
Target Start/End: Complemental strand, 11529601 - 11529498
Alignment:
| Q |
15 |
aattctccaccgccggagccatcaccggagagtctccgccatgtaagccgtatgatcaacagcaaccattacacctcaccttctcgaacaatctactccg |
114 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| ||||| || || | ||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11529601 |
aattctccaccgccgtagccatcaccagagagcctccgtcacgtcatccgtatgatcaaccgaaaccattacacctcaccttctcgaacaatctactccg |
11529502 |
T |
|
| Q |
115 |
atag |
118 |
Q |
| |
|
|||| |
|
|
| T |
11529501 |
atag |
11529498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University