View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9308_low_89 (Length: 215)
Name: NF9308_low_89
Description: NF9308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9308_low_89 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 36 - 199
Target Start/End: Original strand, 23549971 - 23550134
Alignment:
| Q |
36 |
ccgacgaggatactattgataaatcaaaagaagaagataaggccgagggtagtaagggtgagaaaggatcaaaaaagcgtgccagagggaaggttaatga |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23549971 |
ccgacgaggatactattgataaatcaaaagaagaagataaggccgagggtagtaagggtgagaaaggatcaaaaaagcgtgccagagggaaagttaatga |
23550070 |
T |
 |
| Q |
136 |
ggagaaagtgaaagtcaaaaagaaggaactgaagctgccagagccaaagactccaactagtgat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23550071 |
ggagaaagtgaaagtcaaaaagaaggaactgaagctgccagagccaaagactccaactagtgat |
23550134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University