View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9309_low_13 (Length: 236)
Name: NF9309_low_13
Description: NF9309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9309_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 15684322 - 15684109
Alignment:
| Q |
18 |
tcaatatgaatggatatcagattgtccattaatggaata--------ccctaatggacatcaaacactatataaggattgtctcctacacacaatacact |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15684322 |
tcaatatgagtggatatcagattgtccattaatgaaataatggaaaaccctaatggacatcaaacactatataaggattgtctccaacacacaatacact |
15684223 |
T |
 |
| Q |
110 |
agcatattctatcttctcccaatctgtagagtatttgaagcattaagagaatgattgaggaataacgaacttagccgctactaatctttgtcgtgtgttt |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
15684222 |
agcatattctatcttctcccaatccgtagagtatttgaaggattaagagaacgattgaggaataacgaatttagccgctactaatctttgttgtgtgttt |
15684123 |
T |
 |
| Q |
210 |
caaatctctccctc |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15684122 |
caaatctctccctc |
15684109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University