View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9309_low_19 (Length: 205)
Name: NF9309_low_19
Description: NF9309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9309_low_19 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 15440009 - 15439805
Alignment:
| Q |
1 |
caatattttgaaacttttgatgttctttgcctttggacacttgagatagtaaggccgagacatgtcgagactgtatttcaaaactagatccttcaacagg |
100 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||| ||| ||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15440009 |
caatattttgaaacttgtgatgttcattgcctttagactcttgagacagtgaggccgagacatgtcgagactgtatttcgaaactagatccttcaacagg |
15439910 |
T |
|
| Q |
101 |
aattggtgccattttaggtgaagccacacaccgtgatagttgttttaatccaggtctttggactagagatttgactgaacttgacttagcattggcctcg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15439909 |
gattggtgtcattttaggtgaagccacacaccctgatggttgttttaatccaggtttttggactagagatttgactgaacttgacttagcattgacctcg |
15439810 |
T |
|
| Q |
201 |
ggttt |
205 |
Q |
| |
|
||||| |
|
|
| T |
15439809 |
ggttt |
15439805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 143 - 205
Target Start/End: Complemental strand, 15439798 - 15439736
Alignment:
| Q |
143 |
ttttaatccaggtctttggactagagatttgactgaacttgacttagcattggcctcgggttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15439798 |
ttttaatccaggtctttggactagagatttgactgaacctgacttagcattggcctcgggttt |
15439736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University