View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9309_low_3 (Length: 320)
Name: NF9309_low_3
Description: NF9309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9309_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 27 - 304
Target Start/End: Original strand, 488205 - 488489
Alignment:
| Q |
27 |
cttccaattcttacttaattacaaaacctattattcctcattctcctttc-------tcatttcttacacaaacaacgccgattcattctcaaatcccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488205 |
cttccaattcttacttaattacaaaacctattattcctcattctcctttctcatttctcatttcttacacaaacaacgccgattcattctcaaatcccaa |
488304 |
T |
|
| Q |
120 |
atctcaccatggcttcaccacttcgccgaagaagaattccagctcccaaaaaacaatccacgaccttcaacaacaacgacgacgacgtagtttgccagaa |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488305 |
atctcaccatggtttcaccacttcgccgaagaagaattccagctcccaaaaaacaatccacgaccttcaacaacaacgacgacgacgtagtttgccagaa |
488404 |
T |
|
| Q |
220 |
atgcaactccggcaaatccccaactaagttgcttctctgcgacaattgcgacaacggctatcatctcttctgcctcactcctatc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488405 |
atgcaactccggcaaatccccaactaagttgcttctctgcgacaattgcgacaacggctatcatctcttctgcctcactcctatc |
488489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 200 - 294
Target Start/End: Original strand, 500482 - 500576
Alignment:
| Q |
200 |
gacgacgtagtttgccagaaatgcaactccggcaaatccccaactaagttgcttctctgcgacaattgcgacaacggctatcatctcttctgcct |
294 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
500482 |
gacgacattgtttgccagaaatgcaactccggcaaatccccaaccaagttgcttctttgcgacaattgcaacaaaggctaccatctcttctgcct |
500576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University