View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_high_15 (Length: 272)
Name: NF9310_high_15
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 8 - 203
Target Start/End: Original strand, 8803986 - 8804181
Alignment:
| Q |
8 |
atggtgttaggttactcccgtcgcaatcgtgtatccaaatatgtctcaatctaaccgcgtcagttttggcgttttggacacatcaacccactgacttcgg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8803986 |
atggtgttaggttactcccgtcgcaatcgtgtatccacatatgtctcaatctaaccgcgtcagttttggcgttttggacacatcaacccactgacttcgg |
8804085 |
T |
 |
| Q |
108 |
agattaatttattgactactttatgaacccttattgtattacaatggtcaaagtttgcctttccatgttgaaaatcatgcaaatcaaacatgcatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8804086 |
agattaatttattgactactttatgaatccttattgtattacaatggtcaaagtttgccttcccatgttgaaaatcatgcaaatcaaacatgcatg |
8804181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 204 - 258
Target Start/End: Original strand, 8804469 - 8804523
Alignment:
| Q |
204 |
atttattcttgtaacttggcacgaataagcagattagtgaaatgatgaaataaat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8804469 |
atttattcttgtaacttggcacgaataagcagattagtgaaatgatgaactaaat |
8804523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University