View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_high_28 (Length: 244)
Name: NF9310_high_28
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 34867056 - 34866820
Alignment:
| Q |
1 |
tgcatgctaaccagctgccatggaaatgccttatgtgtttcaagaagcttctggaggtcaacgaaaaaacaaatctggtgtctagagttccttggaacta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34867056 |
tgcatgctaaccggctgccatggaaatgccttatgtgtttcaagaagcttctggaggtcaacgaaaaaacagatctggtgtctagagttccttggaacta |
34866957 |
T |
 |
| Q |
101 |
gtttgtcagatttggtttgtcggataattgtggtggttcagcttttaatggattttaagagtggttcatgggttggattgcggtgctttggggtgagctt |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34866956 |
gttagtcagatttggtttgtcggataattgtggtggttcagcttttaatggattttaagagtggttcatggattggattgcggtgctttggggtgagctt |
34866857 |
T |
 |
| Q |
201 |
ttgggtggtagtttaggttgtgtggtggtggtgatgt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34866856 |
ttgggtggtagtttaggttgtgtggtggtggtgatgt |
34866820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 237
Target Start/End: Complemental strand, 16511103 - 16511069
Alignment:
| Q |
203 |
gggtggtagtttaggttgtgtggtggtggtgatgt |
237 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
16511103 |
gggtggcagtttaggttgtgtggtggtggtgatgt |
16511069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University