View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9310_high_31 (Length: 240)

Name: NF9310_high_31
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9310_high_31
NF9310_high_31
[»] chr4 (1 HSPs)
chr4 (18-217)||(47900319-47900518)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 47900518 - 47900319
Alignment:
18 ctatcaatgaagataatgaagttggcatggaactcatggaaattggagcagaaagaacaaaaaatgtgttgattctcatgagtgatactggtggtggaca 117  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47900518 ctatcaatgaagataatgaaggtggcatggaactcatggaaattggagcagaaagaacaaaaaatgtgttgattctcatgagtgatactggtggtggaca 47900419  T
118 tagagcttctgctgaggctattcgtgatgcttttcaaattgaattcggtgatgaatacaaggtactttaatcacacttccttgtgttttggatctgttgc 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
47900418 tagagcttctgctgaggctattcgtgatgcttttcaaattgaattcggtgatgaatacaaggtactttaatcacacttccttctgttttggatctgttgc 47900319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University