View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_high_33 (Length: 225)
Name: NF9310_high_33
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 41346818 - 41346990
Alignment:
| Q |
16 |
agagaacagagtgaggaatgaatttgaacgcatgagaggatcgatgaatgaaacaatgagaaatctaaattgagttgaagagagaataacgattcaacga |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41346818 |
agagaacagagtgaggaaggaatttgaacgcatgagaggat----gaacgaaacaatgagaaatctaaattgagtcgaagagagaataacgatgcaacga |
41346913 |
T |
|
| Q |
116 |
gaactgatatttaagtcgaagagactggatgtggtttttcaaaagacagttctttgtcttaggaacgcaagagcgac |
192 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41346914 |
gaactgatatttaagtcgaagagagtggatgtggtttttcaaaaggcagttctttgtcttaggaacgcaagagcgac |
41346990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University