View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_26 (Length: 349)
Name: NF9310_low_26
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_26 |
 |  |
|
| [»] scaffold0531 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 7 - 149
Target Start/End: Complemental strand, 41381624 - 41381482
Alignment:
| Q |
7 |
tttcgtgttgctgttatcggttattatgtgtttggcaatgaggttaaagataatatcctcatgtctttggaaaaaccagcttggcttattgcaatggcta |
106 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41381624 |
tttcctgttgctattatcggttattatgtgtttggcaatgaggttaaagataatatcctcatgtctttggaaaaaccagcttggcttattgcaatggcta |
41381525 |
T |
 |
| Q |
107 |
acttttttgtggttttacatgtcattggaagctatcaggtaaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41381524 |
acttttttgtggttttacatgtcattggaagctatcaggtaaa |
41381482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 213 - 320
Target Start/End: Complemental strand, 41381418 - 41381309
Alignment:
| Q |
213 |
gatgggatgtcatgatcaaatttagcgaaattttgaagtaattcttaaaatttaaaagtgtcgatctcatttcacgaca--atttagtctttgaaaatat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41381418 |
gatgggatgtcatgatcaaatttagcgaaattttgaagtaattcttaaaatttaaaagtgtcgatctcatttcacgacaatatttagtctttgaaaatat |
41381319 |
T |
 |
| Q |
311 |
attttcataa |
320 |
Q |
| |
|
|||||||||| |
|
|
| T |
41381318 |
attttcataa |
41381309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 5e-44; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 7 - 149
Target Start/End: Complemental strand, 7971187 - 7971045
Alignment:
| Q |
7 |
tttcgtgttgctgttatcggttattatgtgtttggcaatgaggttaaagataatatcctcatgtctttggaaaaaccagcttggcttattgcaatggcta |
106 |
Q |
| |
|
|||| ||||||| |||||||||||| | |||||||||| |||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7971187 |
tttcctgttgctcttatcggttattggatatttggcaatggggttaaggataatatcctcgtgtctttggaaaacccagcttggcttattgcaatggcta |
7971088 |
T |
 |
| Q |
107 |
acttttttgtggttttacatgtcattggaagctatcaggtaaa |
149 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
7971087 |
acttttttgtggttttgcatgtgattggaagctaccaggtaaa |
7971045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 12 - 149
Target Start/End: Original strand, 8042531 - 8042668
Alignment:
| Q |
12 |
tgttgctgttatcggttattatgtgtttggcaatgaggttaaagataatatcctcatgtctttggaaaaaccagcttggcttattgcaatggctaacttt |
111 |
Q |
| |
|
||||||| |||||||||||| | |||||||||| |||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8042531 |
tgttgctattatcggttattggatatttggcaatggggttaaggataatatcctcgtgtctttggaaaacccagcttggcttattgcaatggctaacttt |
8042630 |
T |
 |
| Q |
112 |
tttgtggttttacatgtcattggaagctatcaggtaaa |
149 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
8042631 |
tttgtggttttgcatgtgattggaagttatcaggtaaa |
8042668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 8032622 - 8032764
Alignment:
| Q |
7 |
tttcgtgttgctgttatcggttattatgtgtttggcaatgaggttaaagataatatcctcatgtctttggaaaaaccagcttggcttattgcaatggcta |
106 |
Q |
| |
|
|||| ||||||| |||| ||||||| |||||||| ||||| ||||| |||||| |||| || |||||||||||||||| |||||| || ||||| ||| |
|
|
| T |
8032622 |
tttcctgttgctattattggttattgggtgtttggtaatgaagttaaggataatgtcctaatctctttggaaaaaccagtttggctcatcgcaatatcta |
8032721 |
T |
 |
| Q |
107 |
acttttttgtggttttacatgtcattggaagctatcaggtaaa |
149 |
Q |
| |
|
|| | ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
8032722 |
acctatttgtagttttacatgtaattggaagctatcaggtaaa |
8032764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 221 - 285
Target Start/End: Complemental strand, 7970967 - 7970903
Alignment:
| Q |
221 |
gtcatgatcaaatttagcgaaattttgaagtaattcttaaaatttaaaagtgtcgatctcatttc |
285 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
7970967 |
gtcatgatcaaatttaacgaaatttcaaagtaattcttaaaatttaaatgtatcgatctcatttc |
7970903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 149
Target Start/End: Complemental strand, 7978066 - 7977978
Alignment:
| Q |
61 |
atcctcatgtctttggaaaaaccagcttggcttattgcaatggctaacttttttgtggttttacatgtcattggaagctatcaggtaaa |
149 |
Q |
| |
|
|||||||| ||||| | ||||| || ||||||||||||| |||||| | ||||| ||| | ||||| |||||||||||||||||||| |
|
|
| T |
7978066 |
atcctcatatctttacagaaacctgcatggcttattgcaacagctaacatgtttgttgttattcatgtgattggaagctatcaggtaaa |
7977978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0531 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0531
Description:
Target: scaffold0531; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 149
Target Start/End: Complemental strand, 2457 - 2343
Alignment:
| Q |
35 |
tgtttggcaatgaggttaaagataatatcctcatgtctttggaaaaaccagcttggcttattgcaatggctaacttttttgtggttttacatgtcattgg |
134 |
Q |
| |
|
||||||||||| | ||||| |||||| ||||||| |||||||||||||| |||||||| |||||||| ||||| | ||||| ||||||||||| ||||| |
|
|
| T |
2457 |
tgtttggcaatcaagttaaggataatgtcctcatctctttggaaaaacctgcttggctcattgcaatatctaacctatttgttgttttacatgtaattgg |
2358 |
T |
 |
| Q |
135 |
aagctatcaggtaaa |
149 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2357 |
aagctatcaggtaaa |
2343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 149
Target Start/End: Complemental strand, 14197990 - 14197929
Alignment:
| Q |
88 |
tggcttattgcaatggctaacttttttgtggttttacatgtcattggaagctatcaggtaaa |
149 |
Q |
| |
|
||||||||||||||||| ||| | ||||| ||| | ||||| ||||||||||| |||||||| |
|
|
| T |
14197990 |
tggcttattgcaatggcaaacatgtttgttgttatccatgttattggaagctaccaggtaaa |
14197929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University