View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_33 (Length: 321)
Name: NF9310_low_33
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 7057166 - 7057476
Alignment:
| Q |
1 |
aggcatttaagaaaatgcaagatgttcaggatggtgtgaaagattatgatatggctagtcctcattcatcaccattgagcttcccctttgctaagattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7057166 |
aggcatttaagaaaatgcaagatgttcaggatggtgtgaaagattatgatatggctagtcctcattcatcaccattgagcttcccttttgctaagattat |
7057265 |
T |
 |
| Q |
101 |
gcctgaaccgcaacatacaataattagcagcttgaagagtaccaattcttatatcaatgttggagcctcaccaaagagaaactcacactctaatgtcgat |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7057266 |
gcctgaaccgcaacatacaataattggcagcttgaagagtaccaattcttatatcaatgttggagcctcaccaaagagaaactcacactctaatgtcgat |
7057365 |
T |
 |
| Q |
201 |
atcaggccatcggagattataccaaaaactgttccaccagaaatttcattagctaataatttttctttgccacctcctgcggcccagagtgtatccaagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7057366 |
atcaggccatcggagattataccaaaaactgttccaccagaaatttcattagctaataatttttctttgccacctcctgcggcccagagtgtatccaagg |
7057465 |
T |
 |
| Q |
301 |
acgagtctctg |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
7057466 |
acgagtctctg |
7057476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University