View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_38 (Length: 295)
Name: NF9310_low_38
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 42 - 263
Target Start/End: Original strand, 37308767 - 37308987
Alignment:
| Q |
42 |
tgttgctgaggcatgctaaaattacaaatgaatctgaaattcacaagatgctgaaattcttaaaattaactcacataagctnnnnnnncacgaaaattgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
37308767 |
tgttgctgaggcatgctaaaattacaaatgaatctgaaattcacaagatgctgaaattcttaaaattaactcacataagctaaaaaaacaagaaaattgt |
37308866 |
T |
 |
| Q |
142 |
atagatatttgtttgtgatgcttgtgtttctaaaaaatatttaatggggttgaagtatagtgtgtgtggacattttattgtcagataaaccttgagcaac |
241 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
37308867 |
atagatatttgtctgtgatgcttgtgtttctaaaaaatatttaat-gggttgaagtagtgtgtgtgtggacattttattgtcagataagccttgaggaac |
37308965 |
T |
 |
| Q |
242 |
agttttatttggtgagactttt |
263 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37308966 |
agttttatttggtgagactttt |
37308987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University