View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_43 (Length: 269)
Name: NF9310_low_43
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 20884925 - 20885162
Alignment:
| Q |
18 |
ttatacaaacggttcaacaaatgtagaaatatatatcagatatgcccgtgctgtcagcgtcaatagaaacttatttaatgcagtttgcatcaaaatatca |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20884925 |
ttatacagacggttcaacaaatgtagaaatat--atcagatatgcccgtgctgtcagcgtcaatagaaacttatttaacgcagtttgcatcaaaatatca |
20885022 |
T |
 |
| Q |
118 |
atagagctccaccaaggctccgagtttggaaccaacacaaactgctgcagtttacgttcaaatatcaatagggctcaacgggggccctgaatttggaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20885023 |
atagagctccaccaaggctccgagtttggaaccagcacaaactgctgcagtttacgttcaaatatcaatagggctcaacgggggccctgaatttggaacc |
20885122 |
T |
 |
| Q |
218 |
agcatagactgctgcagcaccaagctcctcctcgatccta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20885123 |
agcatagactgctgcagcaccaagctcctcctcgatccta |
20885162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University