View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_64 (Length: 250)
Name: NF9310_low_64
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 389262 - 389483
Alignment:
| Q |
18 |
aaattaatctgtgtcaccttccaatctagctttatatatgtttgaagtaacttaaagaacaaagaaagatgaattcaagagagtgtgaagttgagcaata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
389262 |
aaattaatctgtgtcaccttccaatctagctttatatatgtttgaagtaacttaaagaacaaagaaagatgaattgaagagagtgcgaagttgagcaata |
389361 |
T |
 |
| Q |
118 |
gaatcttgcaggtaactgttccatgataaagtgggaattctagtctgcagttgttttctcttgaagtagaattaatataacaagtagttacatcccatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
389362 |
gaatcttgcaggtaactgttccatgataaagtgggaattctagtctgcagttgttttctcttgaagtagaattaatataacaagtagttacatcccatca |
389461 |
T |
 |
| Q |
218 |
ttatattggttgttgcctctgt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
389462 |
ttatattggttgttgcctctgt |
389483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University