View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_79 (Length: 239)
Name: NF9310_low_79
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 39 - 206
Target Start/End: Complemental strand, 52579238 - 52579072
Alignment:
| Q |
39 |
ggatttgattcaattcgtgacgtggtttcatctgcattcaacaaatggacaagtgttttgcatgaatcacttgttaccataaatatattgaagtcttgct |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
52579238 |
ggatttgattcaattcgtgacgtggtttcatctgcattcaacaaatggacaagtgttttgcatgaatcacttgttaccataaat-tgaagaagtcttgct |
52579140 |
T |
|
| Q |
139 |
aataatgtgccgaaagttttattacctatgtacgtggaaatgaattggaaccgcagtgtcaccgtgaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52579139 |
aataatgtgccgaaagttttattacctatgtacgtggaaatgaattggaatcgcagtgtcaccgtgaa |
52579072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University