View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_82 (Length: 228)
Name: NF9310_low_82
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 11107705 - 11107494
Alignment:
| Q |
1 |
tataaaaaacatttattgttaatataattacttttgacttcttnnnnnnnn-ttgatgcannnnnnnnn-acacgtagggtggtgtctatatatcaatct |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11107705 |
tataaaaaacatttattgttaatataattacttttgacttcttaaaaaaaaattgatgcattttttttttacacgtagggtggtgtctatatatcaatct |
11107606 |
T |
|
| Q |
99 |
cgtattaaaatttatgnnnnnnnnagaggaaaatttatgtattgttatattgccaaataaatggtcaatgtcttaatagtcttcccggcatttacgttgg |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11107605 |
cgtattaaaatttatgttttttttagaggaaaatttatgtattgttatattgccaaataaatggtcaatgtcttaatagtcttcccggcatttacgttgg |
11107506 |
T |
|
| Q |
199 |
taacaccctttg |
210 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
11107505 |
taacgccctttg |
11107494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University