View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9310_low_84 (Length: 225)

Name: NF9310_low_84
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9310_low_84
NF9310_low_84
[»] chr7 (1 HSPs)
chr7 (16-192)||(41346818-41346990)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 41346818 - 41346990
Alignment:
16 agagaacagagtgaggaatgaatttgaacgcatgagaggatcgatgaatgaaacaatgagaaatctaaattgagttgaagagagaataacgattcaacga 115  Q
    |||||||||||||||||| ||||||||||||||||||||||    ||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||    
41346818 agagaacagagtgaggaaggaatttgaacgcatgagaggat----gaacgaaacaatgagaaatctaaattgagtcgaagagagaataacgatgcaacga 41346913  T
116 gaactgatatttaagtcgaagagactggatgtggtttttcaaaagacagttctttgtcttaggaacgcaagagcgac 192  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||    
41346914 gaactgatatttaagtcgaagagagtggatgtggtttttcaaaaggcagttctttgtcttaggaacgcaagagcgac 41346990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University