View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_85 (Length: 222)
Name: NF9310_low_85
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 69 - 208
Target Start/End: Complemental strand, 45282547 - 45282408
Alignment:
| Q |
69 |
tagagctacagtttttcatactaaaatggccagaaaaagtaccagacgtcaacctcattaaatggatagcaaaatttaaaactaaagtaaagttgttgta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45282547 |
tagagctacagtttttcatactaaaatggccagaaaaagtaccagacgtcaacctcattaaatggatagcaaaatttaaaactaaagtaaagttgttgta |
45282448 |
T |
|
| Q |
169 |
gctcatacaacactaatatcattgtaaggcatacatgcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45282447 |
gctcatacaacactaatatcattgtaaggcatacatgcaa |
45282408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 45283428 - 45283369
Alignment:
| Q |
1 |
ccctaagccataataatgataactggcagtggtcaaacaatgaaacttaaacatcatgtt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45283428 |
ccctaagccataataatgataactggcagtggtcaaacaatgaaacttaaacatcatgtt |
45283369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 45282584 - 45282548
Alignment:
| Q |
56 |
atgttcttcacattagagctacagtttttcatactaa |
92 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45282584 |
atgttcttcacattagagctacaggttttcatactaa |
45282548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University