View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9310_low_89 (Length: 211)
Name: NF9310_low_89
Description: NF9310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9310_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 37667286 - 37667147
Alignment:
| Q |
1 |
catttgttgataaagctataaatcttggtggctttaagttagaattcattctaaaaacaaaatcaatttcacttgaaaaatgtcaatatttgactctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37667286 |
catttgttgataaagctataaatcttggtggcgttaagttagaattcattctaaaaacaaaatcaatttcacttgaaaaatgttaatatttgactctctt |
37667187 |
T |
 |
| Q |
101 |
ttaatttcaattgtttttgcccccacgttttaatttcaat |
140 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
37667186 |
ttaatttcaattgtttttgcccgcacgttttgatttcaat |
37667147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 99 - 195
Target Start/End: Complemental strand, 37667159 - 37667063
Alignment:
| Q |
99 |
ttttaatttcaattgtttttgcccccacgttttaatttcaataacccaatagtcaatgattcattaaaagtcaaatgttctaaataggccatagttc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667159 |
ttttgatttcaattgtttttgcccccacgttttaatttcaataacccaatagtcaatgattcattaaaagtcaaatgttctaaataggccatagttc |
37667063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University