View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_high_17 (Length: 236)
Name: NF9311_high_17
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 15592831 - 15592763
Alignment:
| Q |
23 |
gtcatgctttcttacttgtgtacttcttcaacctgcacaaaaacatttttactttttaatcaccactga |
91 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
15592831 |
gtcatgatttcttacttgtgtacttcttcaacctgcacaagaacatttttaatgtttaatcaccactga |
15592763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 91
Target Start/End: Complemental strand, 15606546 - 15606492
Alignment:
| Q |
37 |
cttgtgtacttcttcaacctgcacaaaaacatttttactttttaatcaccactga |
91 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||| |||||||||||||||||| |
|
|
| T |
15606546 |
cttgtgtacttcttcaacctgcataggaacagctttgctttttaatcaccactga |
15606492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 235
Target Start/End: Complemental strand, 24922046 - 24921977
Alignment:
| Q |
166 |
tcagacgagtgttgaatgcggatgcagtggttaattgtgtgttttgttgtggtatggaagagacatcaac |
235 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
24922046 |
tcagacaagtgttgaatgcggatgcagcggtgaattgtgttttttgcggtggaatggaagagacatcaac |
24921977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University