View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_40 (Length: 282)
Name: NF9311_low_40
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 32191008 - 32190755
Alignment:
| Q |
19 |
ctttgggatgataaccatgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191008 |
ctttgggatgataaccatgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaag |
32190909 |
T |
|
| Q |
119 |
aagatctcctgcagcctccgccaccttcgccttgtccatcggcttttgatctgcagagcctttccccaaacttgattgtgctgcctctgctacaattttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190908 |
aagatctcctgcagcctccgccaccttcgccttgtccatcggcttttgatctgcagagcctttccccaaacttgattgtgctgcctctgctacaattttt |
32190809 |
T |
|
| Q |
219 |
gcactcgccataagctcgctggttgaaatcttcttctcttccccatggctccct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190808 |
gcactcgccataagctcgctggttgaaatcttcttctcttccccatggctccct |
32190755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 133
Target Start/End: Complemental strand, 32210367 - 32210269
Alignment:
| Q |
35 |
atgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaagaagatctcctgcagc |
133 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||| |||||||| || ||||| |
|
|
| T |
32210367 |
atgcagataatcagcagctttatcaacatatgatcctacacctttctgatcatccaatttagcatactgaccaactgcatctagaagatcaccagcagc |
32210269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 178 - 259
Target Start/End: Complemental strand, 32210242 - 32210161
Alignment:
| Q |
178 |
ctttccccaaacttgattgtgctgcctctgctacaatttttgcactcgccataagctcgctggttgaaatcttcttctcttc |
259 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||| | |||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32210242 |
ctttcccaaaacctgactgtgctgcctctgctactacctttgcacttgccattagctcactggttgaaatcttcttctcttc |
32210161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University