View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_43 (Length: 257)
Name: NF9311_low_43
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 3854971 - 3854900
Alignment:
| Q |
19 |
atccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattaacaacaac |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3854971 |
atccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattagcaacaac |
3854900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 169 - 247
Target Start/End: Complemental strand, 3854833 - 3854755
Alignment:
| Q |
169 |
ggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
247 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
3854833 |
ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaatttgtccccaactgcaatgtctttg |
3854755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 164 - 247
Target Start/End: Original strand, 4141819 - 4141902
Alignment:
| Q |
164 |
tcggaggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
247 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4141819 |
tcggaggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaatttgtccccaactgcaatgcctttg |
4141902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 4141667 - 4141730
Alignment:
| Q |
19 |
atccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatatta |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4141667 |
atccgcgcctgcccctctcttcaaagtattgtgattcataaggtttgttaactctatcatatta |
4141730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University