View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_51 (Length: 250)
Name: NF9311_low_51
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 17739377 - 17739141
Alignment:
| Q |
1 |
tgatgttcaagttagtattttgtcaggtaaagtaagcggcttattaggatagtgtgtggacctttctcttggagtatgtgtccttttgtaattgaaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17739377 |
tgatgttcaagttagtattttgtcaggtaaagtaagcggcttattaggatagtgtgtggacctttctcttggagtatgtgtccttttgtaattgaaattt |
17739278 |
T |
|
| Q |
101 |
taggtaaattagagtaagtctcgttcaaactatcgagagaatcttgacgtaatatggggatcaccgtgtaacgttgtttgtgcggtgattgttagctaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17739277 |
taggtaaattagagtaagtctcgttcaaactatcgagagaatcttgacgtaatatggggatcactgtgtaacgttgtttgtgcggtgattgttagctaag |
17739178 |
T |
|
| Q |
201 |
aaggcaagctagcgttagtcgacgaatcagttaccct |
237 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| ||||||| |
|
|
| T |
17739177 |
aaggcacgctagcgttagtcaacggatcaattaccct |
17739141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University