View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_59 (Length: 244)
Name: NF9311_low_59
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_59 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 42393369 - 42393612
Alignment:
| Q |
1 |
agaaccttgtcggatcaaattctagcggtttctcccaaatggaagggtctctatgaatagcccaaacgttcacaaacacacaagacccctttggaattgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393369 |
agaaccttgtcggatcaaattctagcggtttctcccaaatggaagggtctctatgaatagcccaaacgttcacaaacacacaagacccctttggaattgt |
42393468 |
T |
|
| Q |
101 |
gtagcctcctacgttggtggtttcacttgggcaatgaggcattagaagtggaagtgatgggtgcaaacgaagggtttctttcattactgcttgcaagtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393469 |
gtagcctcctacgttggtggtttcacttgggcaatgagacattagaagtggaagtgatgggtgcaaacgaagggtttctttcattactgcttgcaagtag |
42393568 |
T |
|
| Q |
201 |
ggtagcttgtgattatgagactcttctactaagttatctttccc |
244 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42393569 |
ggtagcttgtgaatatgagactcttctactaagttatctttccc |
42393612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 42376817 - 42377057
Alignment:
| Q |
1 |
agaaccttgtcggatcaaattctagcggtttctcccaaatggaagggtctctatgaatagcccaaacgttcacaaacacacaagacccctttggaattgt |
100 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||| |||||||||||||||||||||||||||| | ||| |||| ||| |||| ||||||||| |
|
|
| T |
42376817 |
agaaccttgtaggatcaaattctagtgggttctcccaaacataagggtctctatgaatagcccaaacgttgataaagacacgagatccctctggaattgt |
42376916 |
T |
|
| Q |
101 |
gtagcctcctacgttggtggtttcacttgggcaatgaggcattagaagtggaagtgatgggtgcaaacgaagggtttctttcattactgcttgcaagtag |
200 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||| | || ||||||||||| ||||| |||||||| ||||||||||| ||||| || |||||| |
|
|
| T |
42376917 |
gtagcctccaatgttggtggtttcacttgggcagtgagggactaaaagtggaagtgcagggtgtaaacgaagagtttctttcatcactgcatgtaagtag |
42377016 |
T |
|
| Q |
201 |
ggtagcttgtgattatgagactcttctactaagttatcttt |
241 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42377017 |
gttagcttgtgaatatgagactcttctactaagttatcttt |
42377057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 63 - 244
Target Start/End: Original strand, 42387228 - 42387409
Alignment:
| Q |
63 |
caaacgttcacaaacacacaagacccctttggaattgtgtagcctcctacgttggtggtttcacttgggcaatgaggcattagaagtggaagtgatgggt |
162 |
Q |
| |
|
|||||||| | ||| |||| ||| |||| |||||||||||||||||| | ||||||||||||||||||||| ||||| | || ||||||||||| ||||| |
|
|
| T |
42387228 |
caaacgttgataaagacacgagatccctctggaattgtgtagcctccaatgttggtggtttcacttgggcagtgagggactaaaagtggaagtgttgggt |
42387327 |
T |
|
| Q |
163 |
gcaaacgaagggtttctttcattactgcttgcaagtagggtagcttgtgattatgagactcttctactaagttatctttccc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42387328 |
gcaaacgaagggtttctttcattactgcttgcaagtagggtagcttttgaatatgagactcttctactaagttatctttccc |
42387409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University