View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_62 (Length: 239)
Name: NF9311_low_62
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 6257005 - 6256781
Alignment:
| Q |
1 |
ccttcgacacacaagaagtcagtccctttagtagccatactctaataccactgctagannnnnnnnn--ggtggagggaggaatcatttatattagacta |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
6257005 |
ccttcgacagacaagaagtcagtccctttagtagccatactctaataccactgctagatatttttttttgatggagggagaaatcatttatattagacta |
6256906 |
T |
|
| Q |
99 |
agagaaatcagacatattcacctaatacctcaagacatttaggcatatgatatgagttatctcatttatataatattgttcaatattcatatttttataa |
198 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
6256905 |
aaagaaatcagacatattcacctaataccttaagacatttagacatatggtatgagttatctcatttatataatattgttcaacattcacatttttataa |
6256806 |
T |
|
| Q |
199 |
ctcacacttgccaccgatatttgat |
223 |
Q |
| |
|
|||| | |||||||||||||||||| |
|
|
| T |
6256805 |
ctcatagttgccaccgatatttgat |
6256781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University