View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9311_low_68 (Length: 236)

Name: NF9311_low_68
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9311_low_68
NF9311_low_68
[»] chr1 (2 HSPs)
chr1 (23-91)||(15592763-15592831)
chr1 (37-91)||(15606492-15606546)
[»] chr3 (1 HSPs)
chr3 (166-235)||(24921977-24922046)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 15592831 - 15592763
Alignment:
23 gtcatgctttcttacttgtgtacttcttcaacctgcacaaaaacatttttactttttaatcaccactga 91  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||    
15592831 gtcatgatttcttacttgtgtacttcttcaacctgcacaagaacatttttaatgtttaatcaccactga 15592763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 91
Target Start/End: Complemental strand, 15606546 - 15606492
Alignment:
37 cttgtgtacttcttcaacctgcacaaaaacatttttactttttaatcaccactga 91  Q
    ||||||||||||||||||||||| |  ||||  ||| ||||||||||||||||||    
15606546 cttgtgtacttcttcaacctgcataggaacagctttgctttttaatcaccactga 15606492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 235
Target Start/End: Complemental strand, 24922046 - 24921977
Alignment:
166 tcagacgagtgttgaatgcggatgcagtggttaattgtgtgttttgttgtggtatggaagagacatcaac 235  Q
    |||||| |||||||||||||||||||| ||| |||||||| |||||  |||| |||||||||||||||||    
24922046 tcagacaagtgttgaatgcggatgcagcggtgaattgtgttttttgcggtggaatggaagagacatcaac 24921977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University