View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_73 (Length: 218)
Name: NF9311_low_73
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 131 - 202
Target Start/End: Complemental strand, 37843122 - 37843051
Alignment:
| Q |
131 |
tctttcttcattctctcaccatggagagaattcacgtcaccgtccgtgcaagacctctctcaccggaagatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843122 |
tctttcttcattctctcaccatggagagaattcacgtcaccgtccgtgcaagacctctctcaccggaagatg |
37843051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 13 - 67
Target Start/End: Complemental strand, 37843234 - 37843180
Alignment:
| Q |
13 |
caaaggaggaacgaacaagtcttgggtacttacttctagtccaaattcgtcacac |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843234 |
caaaggaggaacgaacaagtcttgggtacttacttctagtccaaattcgtcacac |
37843180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University