View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_78 (Length: 211)
Name: NF9311_low_78
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 51730670 - 51730483
Alignment:
| Q |
9 |
gaagcagagataagctcaaactttaaaataaccccatttgtagttaaatcctgtaagtaagagccacataaaacagttcaatgggataacaatattgaac |
108 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51730670 |
gaagcataaataagctcaaactttaaaataaccccatttgtagttaaatcctgtaagtaagagccacataaaacagttcaatgggataacaatattgaac |
51730571 |
T |
 |
| Q |
109 |
taaacacacgaagctgtgaataatatatgtatcatgctacatggtttttcaagtaaggttaggaaacctttaatattgactactattt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51730570 |
taaacacacgaagctgtgaataatatatgtatcatgctacatggtttttcaagtaaggttaggaaatctttaatattgactactattt |
51730483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University