View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_82 (Length: 205)
Name: NF9311_low_82
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 27190747 - 27190925
Alignment:
| Q |
20 |
agtgagtgacaaatcaagttactaataggtttttcatttgattttacattttcgtgattatgaactctgatgttatgtgagaaatgggtcatgattttct |
119 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||||||||||| |||||| |||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
27190747 |
agtgagtgacaaataaagttactattcagtttttcatttgattttacattttcatgattaccaactatgaagttatgtgagaaatggttcatgattttct |
27190846 |
T |
 |
| Q |
120 |
gtatggcttttgaagtttggatttgaatcatgaatttttcacttcgactttttattcagatttgtgtcgtctctgcttc |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
27190847 |
gtatggcttttgaagtttagatttgaatcatgaatttttcacttcgactttttattcaggtttgtgtcgtctgtgcttc |
27190925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University