View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9311_low_82 (Length: 205)

Name: NF9311_low_82
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9311_low_82
NF9311_low_82
[»] chr3 (1 HSPs)
chr3 (20-198)||(27190747-27190925)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 27190747 - 27190925
Alignment:
20 agtgagtgacaaatcaagttactaataggtttttcatttgattttacattttcgtgattatgaactctgatgttatgtgagaaatgggtcatgattttct 119  Q
    |||||||||||||| ||||||||| |  ||||||||||||||||||||||||| ||||||  |||| ||| |||||||||||||||| ||||||||||||    
27190747 agtgagtgacaaataaagttactattcagtttttcatttgattttacattttcatgattaccaactatgaagttatgtgagaaatggttcatgattttct 27190846  T
120 gtatggcttttgaagtttggatttgaatcatgaatttttcacttcgactttttattcagatttgtgtcgtctctgcttc 198  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
27190847 gtatggcttttgaagtttagatttgaatcatgaatttttcacttcgactttttattcaggtttgtgtcgtctgtgcttc 27190925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University