View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9311_low_84 (Length: 201)
Name: NF9311_low_84
Description: NF9311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9311_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 7353863 - 7354046
Alignment:
| Q |
1 |
tcagggacaagtgaaatatggtaaaattatctaaagagctctcatcaggaaaattgtaacaatcatgttggtgtctccacaaacattatgagtatttatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353863 |
tcagggacaagtgaaatatggtaaaattatctaaagagctctcatcaggaaaaatgtaacaatcatgttggtgtctccacaaacattatgagtatttatg |
7353962 |
T |
 |
| Q |
101 |
gctggatgactaagtgcaagtatgcatggatcaagagttacagtataaaaagattgatgccatagggactgagcagctattgct |
184 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353963 |
gctggatgactaagtgcaagtatgcacggatcaagagttacaatataaaaagattgatgccatagggactgagcagctattgct |
7354046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University