View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9312_low_10 (Length: 226)
Name: NF9312_low_10
Description: NF9312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9312_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 54202982 - 54202787
Alignment:
| Q |
14 |
caaaggataatccgctggggagaggtgtcattggtcaagggttgtccttgtgtgcaggtggttgttgactcattttcttttttagtgtctcaattttgca |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54202982 |
caaaagataatccgctggggagaggtgtcattggtcaagggttgtccttgtgtgcaggtggttgttgactcattttcttttttagtgtctcaattttgca |
54202883 |
T |
|
| Q |
114 |
gatttatggtttatgatttatggtatcatgtgtttaatcggctagggactgttacaacactgcggaatgaagcgatggctcatctagaacaatttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54202882 |
gatttatggtttatgatttatggtatcatgtgtttaatcggctagggactgttacaacactgcggaatgaagcgatggctcatctataacaatttg |
54202787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 16718816 - 16718865
Alignment:
| Q |
160 |
gactgttacaacactgcggaatgaagcgatggctcatctagaacaatttg |
209 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| ||||||||||||||||| |
|
|
| T |
16718816 |
gactgttacaacactgtgaaatgcagcgatgggtcatctagaacaatttg |
16718865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University