View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9312_low_12 (Length: 210)
Name: NF9312_low_12
Description: NF9312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9312_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 6632271 - 6632139
Alignment:
| Q |
1 |
gcaattttatctaaattaaattatcaaacatattgataaaatactaatattaaggtgaaaatataatttcacatg-nnnnnnnnnccattaaccgaataa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| | ||||||||||||||| |
|
|
| T |
6632271 |
gcaattttatctaaattaaattatcaaacatattgataaaatactaatattaaggtgaaaatagaaattcacaggaaaaaaaaaaccattaaccgaataa |
6632172 |
T |
|
| Q |
100 |
ggaagcaatttgtaaaataagataattaaatta |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6632171 |
ggaagcaatttgtaaaataagataattaaatta |
6632139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 124 - 186
Target Start/End: Complemental strand, 6631313 - 6631251
Alignment:
| Q |
124 |
attaaattatatagcatgattttaataagactaggggtgttcataagattttggaaacacgaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6631313 |
attaaattatatagcatgattttaataagactaggagtgttcataagattttggaaacacgaa |
6631251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University