View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9312_low_7 (Length: 282)
Name: NF9312_low_7
Description: NF9312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9312_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 2510470 - 2510736
Alignment:
| Q |
1 |
tatgacatggaaaacaatggtgtaaaatacaagatgcatatttgtgcaaagaatgaaaataataatattcatgaaggaaggttatggataaatcccagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2510470 |
tatgacatggaaaacaatggtgtaaaatacaagatgcatatttgtgcaaagaatgaaaataataatattcatgaaggaaggttatggataaatccgagac |
2510569 |
T |
 |
| Q |
101 |
tctattttcaaatttttgcatttgcctatctctttatatgttctcatgtcttaaattgcacttatatttttgcagatcctcatctctatatatattgtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
2510570 |
tctattttcaaatttttgcatttgcctatctctttatatgttctcatgtcttaaattgtacttatatttctacagatcctcatctctatatatattgtat |
2510669 |
T |
 |
| Q |
201 |
gtcttgaaacacaacatgagttttagtttcatatggtagaaagtgtatgacaatcttacgtatattg |
267 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2510670 |
gtcttgagacacaacatgagttttagtttcatatggtagaaagtgtatgacaatcttacgtatattg |
2510736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University