View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9312_low_8 (Length: 281)
Name: NF9312_low_8
Description: NF9312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9312_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 264
Target Start/End: Complemental strand, 28441135 - 28440879
Alignment:
| Q |
8 |
ttggtgttagttagtggtgggtatctattcatcatcaaagtgataaaaggaagatggggacagaagttttgtggtaagaatcatgggagaatagagttaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28441135 |
ttggtgttagttagtggtgggtatctattcatcatcaaagtgataaaaggaagatggggacagaagttttggggtaagaatcatgggagaatagagttaa |
28441036 |
T |
 |
| Q |
108 |
tgcatatgtcatgagcttcttgcactttgtatgttatgaaacgacacttcatatgtatatttcaacaaaaagtgagtattctatcacggtaatcacgcat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28441035 |
tgcatatgtcatgagcttcttgcactttgtatgttatgaaacgacacttcatatgtatatttcaacaaaaagtgagtattctatcacggtaatcacgcat |
28440936 |
T |
 |
| Q |
208 |
ccttgtgtcatatttttcatttctgatgcaaccatttctcatctttttccccaaaat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28440935 |
ccttgtgtcatatttttcatttctgatgcaaccatttctcatctttttccccaaaat |
28440879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University