View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9313_low_6 (Length: 417)
Name: NF9313_low_6
Description: NF9313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9313_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 301 - 410
Target Start/End: Complemental strand, 32575502 - 32575391
Alignment:
| Q |
301 |
tgagtaactaaataaactgacaagcactcagccttttgtatggcttgtttatatttttctaaaatat--actgtaaaatactgtaagtggacatccctca |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
32575502 |
tgagtaactaaataaactgacaagcactcagccttttgtatggcttgtttatatttttctaaaatatagacggtaaaatactgtaagtggacatccctca |
32575403 |
T |
|
| Q |
399 |
tcccaaccacca |
410 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32575402 |
tcccaaccacca |
32575391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 280 - 341
Target Start/End: Complemental strand, 32570416 - 32570356
Alignment:
| Q |
280 |
aatatgagatataaacaaacatgagtaactaaataaactgacaagcactcagccttttgtat |
341 |
Q |
| |
|
||||||||||| |||||||| |||||||||| || |||||||| |||||| ||||||||||| |
|
|
| T |
32570416 |
aatatgagatacaaacaaacctgagtaactagatcaactgacatgcactc-gccttttgtat |
32570356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University